PlantPromoterDB promoter information of J033121L14

Summary of Gene (J033121L14)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0220600        NCBI 
Gene model J033121L14  
Description NONE  


Focused view (chromosome 2: 6745718-6746917)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J033121L14                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J033121L14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+6745992J023119N08, J090058G15, J100046F10, J033100M18, AK103901, J023061N01, J013058O03, J033058A19, J033125A21, J013124E21, J100026B11, J023023L03, J033098O13, J023106J17, J090061G20, J090017C24, J090071A08, J065064H24, J090081K06, J053047N10, J053089P04, J033148C12, J090001L06, J090074A08, J090077B15, J100044M01, J100051K14, J100070I06, J090083I05, J100080E17, J100071C04, J100078M13, J100083I09, J043017F03, J043032J02, J100060H18, J090058H23, J090097L10, J065051K09, J090069N23, J100060D22, J090091O22, J023023L21, J023065O09

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGAAGGCCCAACA+67457386745748AK103901, J013058O03, J013124E21, J023023L03, J023023L21, J023061N01, J023065O09, J023106J17, J023119N08, J033058A19, J033098O13, J033100M18, J033125A21, J033148C12, J043017F03, J043032J02, J053047N10, J053089P04, J065051K09, J065064H24, J090001L06, J090017C24, J090058G15, J090058H23, J090061G20, J090069N23, J090071A08, J090074A08, J090077B15, J090081K06, J090083I05, J090091O22, J090097L10, J100026B11, J100044M01, J100046F10, J100051K14, J100060D22, J100060H18, J100070I06, J100071C04, J100078M13, J100080E17, J100083I09
REGAAGGCCCATTTCAGCCCAACA+67457596745779AK103901, J013058O03, J013124E21, J023023L03, J023023L21, J023061N01, J023065O09, J023106J17, J023119N08, J033058A19, J033098O13, J033100M18, J033125A21, J033148C12, J043017F03, J043032J02, J053047N10, J053089P04, J065051K09, J065064H24, J090001L06, J090017C24, J090058G15, J090058H23, J090061G20, J090069N23, J090071A08, J090074A08, J090077B15, J090081K06, J090083I05, J090091O22, J090097L10, J100026B11, J100044M01, J100046F10, J100051K14, J100060D22, J100060H18, J100070I06, J100071C04, J100078M13, J100080E17, J100083I09
 OsREG430AAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG657          TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511           CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG594             GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGTTACAGCCCAACA+67457986745816AK103901, J013058O03, J013124E21, J023023L03, J023023L21, J023061N01, J023065O09, J023106J17, J023119N08, J033058A19, J033098O13, J033100M18, J033125A21, J033148C12, J043017F03, J043032J02, J053047N10, J053089P04, J065051K09, J065064H24, J090001L06, J090017C24, J090058G15, J090058H23, J090061G20, J090069N23, J090071A08, J090074A08, J090077B15, J090081K06, J090083I05, J090091O22, J090097L10, J100026B11, J100044M01, J100046F10, J100051K14, J100060D22, J100060H18, J100070I06, J100071C04, J100078M13, J100080E17, J100083I09
 OsREG435        ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511         CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG594           GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAGA+67458296745838AK103901, J013058O03, J013124E21, J023023L03, J023023L21, J023061N01, J023065O09, J023106J17, J023119N08, J033058A19, J033098O13, J033100M18, J033125A21, J033148C12, J043017F03, J043032J02, J053047N10, J053089P04, J065051K09, J065064H24, J090001L06, J090017C24, J090058G15, J090058H23, J090061G20, J090069N23, J090071A08, J090074A08, J090077B15, J090081K06, J090083I05, J090091O22, J090097L10, J100026B11, J100044M01, J100046F10, J100051K14, J100060D22, J100060H18, J100070I06, J100071C04, J100078M13, J100080E17, J100083I09
REGATCGGACGG+67458936745901AK103901, J013058O03, J013124E21, J023023L03, J023023L21, J023061N01, J023065O09, J023106J17, J023119N08, J033058A19, J033098O13, J033100M18, J033125A21, J033148C12, J043017F03, J043032J02, J053047N10, J053089P04, J065051K09, J065064H24, J090001L06, J090017C24, J090058G15, J090058H23, J090061G20, J090069N23, J090071A08, J090074A08, J090077B15, J090081K06, J090083I05, J090091O22, J090097L10, J100026B11, J100044M01, J100046F10, J100051K14, J100060D22, J100060H18, J100070I06, J100071C04, J100078M13, J100080E17, J100083I09
REGCTCGCGCG+67459116745918AK103901, J013058O03, J013124E21, J023023L03, J023023L21, J023061N01, J023065O09, J023106J17, J023119N08, J033058A19, J033098O13, J033100M18, J033125A21, J033148C12, J043017F03, J043032J02, J053047N10, J053089P04, J065051K09, J065064H24, J090001L06, J090017C24, J090058G15, J090058H23, J090061G20, J090069N23, J090071A08, J090074A08, J090077B15, J090081K06, J090083I05, J090091O22, J090097L10, J100026B11, J100044M01, J100046F10, J100051K14, J100060D22, J100060H18, J100070I06, J100071C04, J100078M13, J100080E17, J100083I09

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.