version
PlantPromoterDB promoter information of J033124J09

Summary of Gene (J033124J09)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0836400        NCBI 
Gene model J033124J09  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 37600460-37601659)

Genome position     
from initiation codon
AK068741            
AK073540            
J023019D11          
J023139O22          
J033042J20          
J033046M18          
J075150O14          
J090008C18          
J090015E05          
J090016D03          
J090076J09          
TSS from cDNA
TSS information
J033124J09                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033124J09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+37600522-938
TSS clone peakAclone+37601127-333

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCT+3760050837600515-952-945
Y PatchTCCCCCTCC+3760113237601140-328-320
Y PatchCCCCTCCTCTCTC+3760115537601167-305-293
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGTGGGCCCAAAC+3760034637600359-1114-1101
 OsREG597TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625     GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593      GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGACGTGGCG+3760036337600371-1097-1089
 OsREG585GACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448 ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGACGTGGGCCCCA+3760093837600949-522-511
 OsREG449ACGTGGGC     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC+3760100237601009-458-451
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGGTTGGGCCTG+3760103537601044-425-416
 OsREG626GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG471 TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513  TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCT+3760105537601063-405-397
 OsREG592TTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCGTT+3760106637601076-394-384
 OsREG646TCAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.