version
PlantPromoterDB promoter information of J033125G24

Summary of Gene (J033125G24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0793100        NCBI 
Gene model J033125G24  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 33837586-33836387)

Genome position     
from initiation codon
AK067897            
J065132N21          
TSS from cDNA
TSS information
J033125G24                       5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033125G24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-33836846-260

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC-3383686133836868-275-282
Y PatchTTCCCCTCCTCTCCCTTCCTCTT-3383687033836892-284-306
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGACCCACGTGGGCCCCACA-3383692433836946-338-360
 OsREG650GTGGGACC                PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC               PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA              PPDB MotifGGGACCC  PLACE Motif 
 OsREG622   GGACCCAC             PPDB MotifGGGACCC  PLACE Motif 
 OsREG508      CCCACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG449         ACGTGGGC       PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571          CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647            TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641             GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631              GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611               GCCCCACA PPDB Motif  PLACE Motif 
REGACGTGGCG-3383695733836964-371-378
 OsREG448ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTCCCTCA-3383708133837088-495-502
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGAATGGGCT-3383712433837131-538-545
 OsREG432AATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCAC-3383713633837146-550-560
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.