version
PlantPromoterDB promoter information of J033126F06

Summary of Gene (J033126F06)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0510100        NCBI 
Gene model J033126F06  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 19014432-19013233)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J033126F06                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033126F06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-19014641-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACAGGTGGG-1901472519014734-143-152
 OsREG501GACAGGTG   PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG  PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGCCCGC-1901475819014769-176-187
 OsREG486ATCTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG  PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTC-1901477719014784-195-202
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGTGTGGGGCCACGTCACAGTGGGCCCCA-1901481219014840-230-258
 OsREG526CGTGTGGG                      PPDB MotifGCCCA  PLACE Motif 
 OsREG535 GTGTGGGG                     PPDB Motif  PLACE Motif 
 OsREG611  TGTGGGGC                    PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC                   PPDB Motif  PLACE Motif 
 OsREG585        GCCACGTC              PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505          CACGTCAC            PPDB MotifACGT  PLACE MotifTGAC 
 OsREG478                  AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640                   GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647                    TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641                     GGGCCCCA PPDB MotifGCCCA  PLACE Motif 
REGGTGTGGGG-1901490319014910-321-328
 OsREG535GTGTGGGG PPDB Motif  PLACE Motif 
REGGTTTGGGC-1901493319014940-351-358
 OsREG593GTTTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.