version
PlantPromoterDB promoter information of J033126K03

Summary of Gene (J033126K03)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0736100        NCBI 
Gene model J033126K03  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 32453468-32452269)

Genome position     
from initiation codon
011-091-H04         
015-004-D10         
AK064298            
AK099365            
AK103355            
J033044B20          
J033094G06          
J033111N02          
J033111P10          
J043034D12          
TSS from cDNA
TSS information
J033126K03                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033126K03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-32452550-82
TSS clone peakAclone-32452498-30
TSS cloneGclone-32452491-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTGGGC-3245255132452558-83-90
 OsREG547CCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCTTTT-3245258832452599-120-131
 OsREG592TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGCCCACGTG-3245264832452655-180-187
 OsREG508CCCACGTG PPDB MotifACGT  PLACE Motif 
REGCCGTCGGATC-3245270732452716-239-248
 OsREG546CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC PPDB MotifCCGAC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.