version
PlantPromoterDB promoter information of J033127J04

Summary of Gene (J033127J04)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0350500        NCBI 
Gene model J033127J04  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 16529297-16530496)

Genome position     
from initiation codon
005-018-G10         
011-057-B07         
012-058-H07         
012-096-A03         
013-053-H02         
013-071-D05         
013-090-F08         
016-070-C08         
AF020787            
AK061712            
AK102897            
J013025J05          
J033060G23          
J033112P14          
J090015L18          
J090047K03          
J090097J17          
TSS from cDNA
TSS information
J033127J04                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033127J04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+16530036-261
TSS clone peakAclone+16530039-258

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTC+1653004116530048-256-249
Y PatchCCCCCTCC+1653007316530080-224-217
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACCA+1652973816529746-559-551
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGGCCGTTGGAT+1652977816529787-519-510
 OsREG518GCCGTTGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 CCGTTGGA  PPDB MotifCCAACGG  PLACE Motif 
 OsREG481  CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGATCGGACGGA+1652980216529811-495-486
 OsREG484ATCGGACG   PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG  PPDB Motif  PLACE Motif 
 OsREG561  CGGACGGA PPDB Motif  PLACE Motif 
REGCACGTGGC+1652984816529855-449-442
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCGGGCCG+1652985916529867-438-430
 OsREG539CCCGGGCC  PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG PPDB Motif  PLACE Motif 
REGGTGGCCCACCC+1652988616529896-411-401
 OsREG653GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600   GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGGGACCCACCTGTCAGTG+1652994916529965-348-332
 OsREG622GGACCCAC          PPDB MotifGGGACCC  PLACE Motif 
 OsREG514   CCCACCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG436    CCACCTGT      PPDB Motif  PLACE Motif 
 OsREG501     CACCTGTC     PPDB Motif  PLACE Motif 
 OsREG551       CCTGTCAG   PPDB Motif  PLACE MotifTGAC 
 OsREG453        CTGTCAGT  PPDB Motif  PLACE MotifTGAC 
 OsREG510         TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGCCCCCGCG+1652997516529982-322-315
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.