version
PlantPromoterDB promoter information of J033127J08

Summary of Gene (J033127J08)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0624000        NCBI 
Gene model J033127J08  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 26883925-26885124)

Genome position     
from initiation codon
AK067726            
AK067757            
J013039E03          
J013040D22          
J013047K12          
J013056C04          
J013062K01          
J013108K09          
J013126I24          
J013128D18          
J013147D23          
J013154N13          
J023003C20          
J023003N19          
J023007B09          
J023008L12          
J023037O10          
J023044F11          
J023062H22          
J023064O07          
J023067D16          
J023082C19          
J023090A08          
J023102P21          
J023122G15          
J023123I24          
J023134N07          
J023140M21          
J033023G06          
J033025J02          
J033025L06          
J033026I21          
J033028G20          
J033028L03          
J033030P14          
J033031C02          
J033031I06          
J033037D21          
J033037M24          
J033040P06          
J033046J18          
J033048A14          
J033048B14          
J033051N03          
J033060A19          
J033060K19          
J033065O13          
J033067I23          
J033068N13          
J033070N02          
J033072K15          
J033073D09          
J033075H17          
J033076O22          
J033086K06          
J033086L03          
J033088J09          
J033091D17          
J033096B11          
J033099A05          
J033101B15          
J033101D20          
J033105D22          
J033106J20          
J033107J01          
J033111N08          
J033112B18          
J033113L04          
J033114F02          
J033118A22          
J033119J02          
J033120F22          
J033120O16          
J033127A12          
J033127N13          
J033131N09          
J033135I05          
J033140D04          
J033142D04          
J033145B14          
J043007I15          
J043021N20          
J043037I05          
J065008P22          
J065038C05          
J065060A16          
J065111M10          
J065112L11          
J065114B07          
J065116M04          
J065152D15          
J065171C15          
J065173N07          
J065185N18          
J065187F09          
J065188L15          
J065190K15          
J065214C16          
J065215F05          
J075108J08          
J090002C16          
J090002K12          
J090003M10          
J090007J12          
J090010D06          
J090010F21          
J090014E20          
J090014J03          
J090017E15          
J090019J18          
J090021B21          
J090021H21          
J090021J12          
J090022K10          
J090024C24          
J090026D12          
J090034F08          
J090036H24          
J090036L04          
J090040C21          
J090045J21          
J090052D21          
J090053A01          
J090057E01          
J090059A01          
J090059M24          
J090062A08          
J090065H17          
J090073M22          
J090074J05          
J090074L22          
J090077E04          
J090077K10          
J090088E21          
J090088L13          
J090089M05          
J090092E18          
J090092P07          
J090096M04          
J090099I04          
J100023P11          
J100024K13          
J100026P20          
J100027I15          
J100027M21          
J100029H05          
J100030E10          
J100030F11          
J100031C13          
J100032P16          
J100034G02          
J100037D06          
J100050D08          
J100051J22          
J100055G12          
J100056O15          
J100057E06          
J100061P11          
J100064H05          
J100066D14          
J100067D10          
J100070L11          
J100071N11          
J100073D21          
J100074L06          
J100081I01          
J100083F08          
J100083I15          
J100084P13          
J100086N12          
TSS from cDNA
TSS information
J033127J08                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033127J08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+26884633-292

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCACTTTGGGCTGGG+2688453626884554-389-371
 OsREG527CCCACCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG457        TTTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG511         TTGGGCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG523          TGGGCTGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG533           GGGCTGGG PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG+2688457626884583-349-342
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.