version
PlantPromoterDB promoter information of J033128M07

Summary of Gene (J033128M07)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0597000        NCBI 
Gene model J033128M07  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24981876-24980677)

Genome position     
from initiation codon
009-013-A01         
009-077-A02         
009-195-H04         
AF094773            
AK062134            
AK103429            
J013088G19          
J013152D01          
J023024K09          
J023058J15          
J023097I07          
J023132B05          
J033065L11          
J033086B12          
J043010M23          
J043024A05          
J053057P08          
J065022G24          
J065028I10          
J065065D08          
J065103D22          
J065153K16          
J065210B16          
J075015H18          
J075102C14          
J080302G09          
J080302L20          
J080303K11          
J080312C18          
J080316F08          
J090023I05          
J090023I07          
J090053C21          
J090067J22          
J090070E24          
J090078H04          
J090089P06          
J090092E21          
J100014G01          
J100022L20          
J100024I05          
J100025L08          
J100030J03          
J100031K12          
J100036N01          
J100050C23          
J100062G12          
J100067L17          
J100074O09          
TSS from cDNA
TSS information
J033128M07                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033128M07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24981120-244
TSS clone peakGclone-24981118-242

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCGTATAAATG-2498114424981154-268-278
Y PatchCCTCCCTCTCTCTC-2498107824981091-202-215
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGGTGG-2498119724981204-321-328
 OsREG436ACAGGTGG PPDB Motif  PLACE Motif 
REGGGGACCCAC-2498121524981223-339-347
 OsREG637GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622 GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGACAGGTGGG-2498123724981246-361-370
 OsREG501GACAGGTG   PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG  PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC-2498126324981270-387-394
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGCACGTGTCC-2498130924981317-433-441
 OsREG509CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451 ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCATGG-2498136024981367-484-491
 OsREG525GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.