version
PlantPromoterDB promoter information of J033133I10

Summary of Gene (J033133I10)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0406600        NCBI 
Gene model J033133I10  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 20238846-20237647)

Genome position     
from initiation codon
AK103609            
J075092D11          
J100031M09          
TSS from cDNA
TSS information
J033133I10                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033133I10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20237976-130

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCACCTATATATC-2023800420238015-158-169
Y PatchCCCCCCTCCCTTCCTC-2023797720237992-131-146
Y PatchCCCCTTCC-2023799720238004-151-158
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACCAAC-2023806120238068-215-222
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCCCAGCCCACGC-2023807820238089-232-243
 OsREG533CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG463   AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602    GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGGGCCGTGG-2023814620238153-300-307
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGGCGCGCGAG-2023819420238202-348-356
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558 CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGGGGGGATG-2023824020238247-394-401
 OsREG516GGGGGATG PPDB Motif  PLACE Motif 
REGCGCGACGCG-2023826020238268-414-422
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.