version
PlantPromoterDB promoter information of J033135H16

Summary of Gene (J033135H16)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0461300        NCBI 
Gene model J033135H16  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 22698988-22697789)

Genome position     
from initiation codon
009-157-H09         
AK111917            
AK111946            
AK111972            
AK112021            
J033066I04          
J043036O11          
TSS from cDNA
TSS information
J033135H16                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033135H16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-22698300-312
TSS clone peakAclone-22698237-249

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCC-2269821722698226-229-238
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGGCCCACCAAC-2269848422698496-496-508
 OsREG577CTGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520     CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGAATTGGGCCCCACTCC-2269850122698516-513-528
 OsREG433AATTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG532        CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGCCCCCACGCG-2269854122698550-553-562
 OsREG536CCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530  CCCACGCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.