version
PlantPromoterDB promoter information of J033136G07

Summary of Gene (J033136G07)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0124600        NCBI 
Gene model J033136G07  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 1279479-1280678)

Genome position     
from initiation codon
AK073437            
J033042K24          
J065092I12          
J065132F04          
J065143I11          
TSS from cDNA
TSS information
J033136G07                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033136G07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1280407-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAATC+12803761280383-103-96
Y PatchTCTCTCCCC+12804301280438-49-41
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGACCCACCTGTC+12801401280155-339-324
 OsREG650GTGGGACC         PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA       PPDB MotifGGGACCC  PLACE Motif 
 OsREG622   GGACCCAC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG514      CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC PPDB Motif  PLACE Motif 
REGGGACGCGTCTC+12802491280259-230-220
 OsREG442GGACGCGT    PPDB Motif  PLACE Motif 
 OsREG560   CGCGTCTC PPDB Motif  PLACE Motif 
REGGATCCGACGGCCCGGA+12802961280311-183-168
 OsREG588GATCCGAC         PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG       PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584     GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446      ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544       CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG633        GGCCCGGA PPDB Motif  PLACE Motif 
REGCCGAGCCGTCCATCCCCC+12803291280346-150-133
 OsREG540CCGAGCCG           PPDB Motif  PLACE Motif 
 OsREG468   AGCCGTCC        PPDB Motif  PLACE Motif 
 OsREG516          CATCCCCC PPDB Motif  PLACE Motif 
REGCCCCCACGAA+12803561280365-123-114
 OsREG536CCCCCACG   PPDB Motif  PLACE Motif 
 OsREG529  CCCACGAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.