version
PlantPromoterDB promoter information of J033139J18

Summary of Gene (J033139J18)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0950900        NCBI 
Gene model J033139J18  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 43663830-43665029)

Genome position     
from initiation codon
AK101121            
J023036H24          
J023084G23          
J033025J04          
J075041N19          
J075045D15          
J090006A09          
J090036D02          
TSS from cDNA
TSS information
J033139J18                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033139J18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+43664797-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACAC+4366455343664560-277-270
 OsREG598GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCGCGTCGC+4366457743664590-253-240
 OsREG540CCGAGCCG       PPDB Motif  PLACE Motif 
 OsREG559      CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCCGAGCCGAGCCG+4366459943664611-231-219
 OsREG540CCGAGCCGAGCCG PPDB Motif  PLACE Motif 
REGAGATGGGCCTTGGCCCATGA+4366462243664641-208-189
 OsREG456AGATGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG660         TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488          TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517           GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609            GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCGAG+4366464743664657-183-173
 OsREG478AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG575   GGGCCGAG PPDB MotifGCCCA  PLACE Motif 
REGCACGTGTCG+4366467643664684-154-146
 OsREG509CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452 ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGCCACGT+4366469643664703-134-127
 OsREG448CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGCCACGTC+4366472743664735-103-95
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.