PlantPromoterDB promoter information of J033148H23
Summary of Gene (J033148H23)
|
Overview
|
Focused view (chromosome 9: 21480620-21479421)
|
Genome position
from initiation codon TSS from cDNA TSS information J033148H23 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of J033148H23
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | G | clone | - | 21481626 | -256 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTCTCTCCC | - | 21481590 | 21481599 | -220 | -229 |
| Y Patch | TTCCTCCCTC | - | 21481614 | 21481623 | -244 | -253 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GCCCCACCAC | - | 21481684 | 21481693 | -314 | -323 | |||
| OsREG612 | GCCCCACC | PPDB Motif | PLACE Motif | ||||||
| OsREG527 | CCCACCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGTGGGGCC | - | 21481716 | 21481724 | -346 | -354 | |||
| OsREG612 | GGTGGGGC | PPDB Motif | PLACE Motif | ||||||
| OsREG631 | GTGGGGCC | PPDB Motif | PLACE Motif | ||||||
| REG | GGTGGGGC | - | 21481740 | 21481747 | -370 | -377 | |||
| OsREG612 | GGTGGGGC | PPDB Motif | PLACE Motif | ||||||
| REG | CGTGGACC | - | 21481760 | 21481767 | -390 | -397 | |||
| OsREG570 | CGTGGACC | PPDB Motif | PLACE Motif | ||||||
| REG | TCTGGCCCCACCTGTCAGTG | - | 21481897 | 21481916 | -527 | -546 | |||
| OsREG638 | TCTGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG631 | GGCCCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG612 | GCCCCACC | PPDB Motif | PLACE Motif | ||||||
| OsREG514 | CCCACCTG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG436 | CCACCTGT | PPDB Motif | PLACE Motif | ||||||
| OsREG501 | CACCTGTC | PPDB Motif | PLACE Motif | ||||||
| OsREG551 | CCTGTCAG | PPDB Motif | PLACE Motif | TGAC | |||||
| OsREG453 | CTGTCAGT | PPDB Motif | PLACE Motif | TGAC | |||||
| OsREG510 | TGTCAGTG | PPDB Motif | PLACE Motif | TGAC | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||