version
PlantPromoterDB promoter information of J043003L24

Summary of Gene (J043003L24)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0888700        NCBI 
Gene model J043003L24  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 40392252-40391053)

Genome position     
from initiation codon
AK073376            
J033030B16          
J033098D06          
J033112A12          
TSS from cDNA
TSS information
J043003L24                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J043003L24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-40391418-166

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCTCTCCCTTCCTCCC-4039144840391467-196-215
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGCCCACGCCTC-4039146740391481-215-229
 OsREG440ACCGGCCC        PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG602    GCCCACGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG503       CACGCCTC PPDB Motif  PLACE Motif 
REGCGTTCCGT-4039150540391512-253-260
 OsREG444CGTTCCGT PPDB Motif  PLACE Motif 
REGGAGGCCCATAA-4039152640391536-274-284
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCGGCCCAAT-4039157140391586-319-334
 OsREG454ACTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492        GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGGGCCGAGA-4039163040391637-378-385
 OsREG635GGCCGAGA PPDB Motif  PLACE Motif 
REGAGCCGTTG-4039166140391668-409-416
 OsREG469AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.