version
PlantPromoterDB promoter information of J043005F08

Summary of Gene (J043005F08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0626100        NCBI 
Gene model J043005F08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 26650650-26651849)

Genome position     
from initiation codon
AK066892            
J013050G23          
J013060F03          
J013088A19          
J013105M18          
J013108D15          
J013118M09          
J023009J17          
J023078I22          
J023103F15          
J023105B22          
J033024C18          
J033032N02          
J033041E20          
J033068L19          
J033076E16          
J033084J03          
J033090A13          
J033106C19          
J033111H05          
J033116N13          
J033127C24          
J033129M02          
J033145J02          
J043007L22          
J043031E03          
J043035J19          
J053027K20          
J065058I24          
J065078A06          
J065085E09          
J065093L04          
J065099H07          
J065102D09          
J065136J19          
J065182P21          
J065200F03          
J090004E22          
J090013K22          
J090019A03          
J090057B09          
J090066F19          
J090071M22          
J090075E16          
J090086D23          
TSS from cDNA
TSS information
J043005F08                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J043005F08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26651589-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCATCCACC+2665130926651316-341-334
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGTAATGGGCCCACTTG+2665150226651516-148-134
 OsREG610TAATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498       CCCACTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.