version
PlantPromoterDB promoter information of J043022E03

Summary of Gene (J043022E03)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0605600        NCBI 
Gene model J043022E03  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 24586252-24587451)

Genome position     
from initiation codon
016-017-B02         
AK066104            
J013052G16          
J065105P10          
TSS from cDNA
TSS information
J043022E03                       5'->3' (+)
Promoter sequence








 
016-043-G05         
AK067496            
J013109L15          
J033138H02          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J043022E03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+24587154-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCC+2458712424587132-128-120
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTCGCGTC+2458690924586919-343-333
 OsREG559CGCGTCGC    PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GTCGCGTC PPDB Motif  PLACE Motif 
REGAAGGCCCACGA+2458694724586957-305-295
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCGC+2458699424587004-258-248
 OsREG609TCATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGGGCCGTCC+2458700724587014-245-238
 OsREG624GGCCGTCC PPDB Motif  PLACE Motif 
REGAGCCCATCCAGCCCATCTGGACC+2458702124587043-231-209
 OsREG466AGCCCATC AGCCCATC       PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GCCCATCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG534  CCCATCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG523       CCAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG491        CAGCCCAT        PPDB MotifGCCCA  PLACE Motif 
 OsREG456          GCCCATCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG649               TCTGGACC PPDB Motif  PLACE Motif 
REGGATCCGACGGCCCG+2458705424587067-198-185
 OsREG588GATCCGAC       PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG      PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584     GACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446      ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGGGTGTGTGGGG+2458709124587101-161-151
 OsREG499GGTGTGTG    PPDB Motif  PLACE Motif 
 OsREG535   GTGTGGGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.