version
PlantPromoterDB promoter information of J043026K08

Summary of Gene (J043026K08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0144600        NCBI 
Gene model J043026K08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 2401399-2402598)

Genome position     
from initiation codon
006-037-H02         
AK061501            
AK102823            
J033108P10          
J090009H21          
J090071M11          
J090073B22          
TSS from cDNA
TSS information
J043026K08                       5'->3' (+)
Promoter sequence












 
                    
Os01g0144500        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J043026K08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+2402276-123
TSS clone peakGclone+2402284-115

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTCCTCTCTCTCT+24022612402279-138-120
Y PatchCCTCCTCCCC+24022922402301-107-98
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCCCACA+24021252402136-274-263
 OsREG441ACCGGGCC     PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCGCACGCCAC+24021962402213-203-186
 OsREG627TGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG566  TGGGCCCG         PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619   GGGCCCGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG632    GGCCCGCA       PPDB Motif  PLACE Motif 
 OsREG502          CACGCCAC PPDB Motif  PLACE Motif 
REGACCGGGCCGTGGTGATGGGCCCG+24022202402242-179-157
 OsREG441ACCGGGCC                PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG               PPDB Motif  PLACE Motif 
 OsREG446  CGGGCCGT              PPDB MotifACGGGC  PLACE Motif 
 OsREG504   GGGCCGTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG521    GGCCGTGG            PPDB Motif  PLACE Motif 
 OsREG607            TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590             GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489              ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566               TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.