version
PlantPromoterDB promoter information of J043034B05

Summary of Gene (J043034B05)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0174350        NCBI 
Gene model J043034B05  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 6: 3760999-3762198)

Genome position     
from initiation codon
009-115-D07         
J013160M17          
J043016F19          
J075193O04          
J080029J01          
J080031N22          
J080038C20          
J080066H20          
TSS from cDNA
TSS information
J043034B05                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J043034B05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+3761944-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTGGGCCTAGTTGGGCCGGA+37617793761799-220-200
 OsREG478AGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG479         AGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626          GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563           TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542            TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644             GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGC+37618053761812-194-187
 OsREG433AATTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGTCCCTCA+37618513761858-148-141
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGCCCGGCCCACT+37618833761893-116-106
 OsREG538CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.