version
PlantPromoterDB promoter information of J053032M06

Summary of Gene (J053032M06)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0430100        NCBI 
Gene model J053032M06  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 21350949-21352148)

Genome position     
from initiation codon
009-125-A01         
AK102190            
J033087A06          
J065033D05          
J065045D15          
J065045K10          
J065049N05          
J065064N09          
J065068F17          
J065088F17          
J065104N22          
J065117B19          
J065119O12          
J065134G24          
J065150G16          
J065176C03          
J065212M23          
J075009P18          
J075019G06          
J075037H14          
J075057C13          
J075100E14          
J075120I16          
J075130F07          
J075156M16          
J100043J03          
TSS from cDNA
TSS information
J053032M06                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J053032M06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+21351857-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGACTATATAAAAG+2135181321351826-136-123
Y PatchCCTCCTCCTC+2135187821351887-71-62
Y PatchCCCTCCCC+2135188921351896-60-53
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGGAC+2135165121351658-298-291
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGAAGGCCCATTA+2135172521351735-224-214
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCTGAAAAGCCCAGCCC+2135174621351769-203-180
 OsREG425AACTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT               PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG419           AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG421            AAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG428             AAGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG464              AGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603               GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533                CCCAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.