version
PlantPromoterDB promoter information of J053043N11

Summary of Gene (J053043N11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0558600        NCBI 
Gene model J053043N11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 22804081-22802882)

Genome position     
from initiation codon
006-120-G12         
J013100N20          
J033043P09          
J033125M18          
J053026O03          
J053031O20          
J053100E24          
J065008E07          
J065080O16          
J065138E24          
J075002G24          
J075076L07          
J075085G02          
J075096A04          
J075123C09          
J075158E16          
J100033K07          
J100084E08          
S66160              
TSS from cDNA
TSS information
J053043N11                       5'->3' (-)
Promoter sequence
















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J053043N11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-22803191-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCCCC-2280316422803171-83-90
Y PatchCCCCCCTCCCCTCCT-2280318422803198-103-117
Y PatchTCTCCTCTCCCCC-2280322822803240-147-159
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGACGTG-2280327722803284-196-203
 OsREG506GAGACGTG PPDB MotifACGT  PLACE Motif 
REGCCACCAAC-2280336922803376-288-295
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGGGTGGGCCCCACG-2280341122803424-330-343
 OsREG600GGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG PPDB Motif  PLACE Motif 
REGATCTCGGCCCGGCCCGGCCCAACT-2280344222803465-361-384
 OsREG485ATCTCGGC                 PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC                PPDB Motif  PLACE Motif 
 OsREG575  CTCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG568   TCGGCCCG              PPDB MotifACGGGC  PLACE Motif 
 OsREG544    CGGCCCGGCCCGG        PPDB Motif  PLACE Motif 
 OsREG616     GGCCCGGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614      GCCCGGCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538       CCCGGCCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542             CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563              CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626               GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479                GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.