version
PlantPromoterDB promoter information of J053048H24

Summary of Gene (J053048H24)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0158900        NCBI 
Gene model J053048H24  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 3438198-3436999)

Genome position     
from initiation codon
AK067062            
J013036K19          
J013071G03          
J013089F04          
J013092D16          
J033120K14          
J033133F24          
J033145A10          
J033145A11          
J053075H10          
TSS from cDNA
TSS information
J053048H24                       5'->3' (-)
Promoter sequence






 
AK073617            
AK103973            
J023130H14          
J033051J11          
J065101C10          
J065168B04          
J065184E22          
J080021D11          
J080025H10          
J080026N19          
J080034A12          
J080040L02          
J080042H19          
J080047B05          
J080047E09          
J080047I01          
J080052H19          
J080062K13          
J080063A22          
J080068G18          
J080068N19          
J080076G08          
J080077H13          
J080077K06          
J080093D15          
J080094D21          
J080097A20          
J080097E21          
J080097N17          
J100071K18          
J100072F09          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J053048H24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-3437228-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCACGA-34372693437279-71-81
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGTTGTGGGCTGG-34372913437301-93-103
 OsREG597TTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG461 TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAAG-34373143437323-116-125
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCTGG-34373363437346-138-148
 OsREG592TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCAATT-34373683437379-170-181
 OsREG419AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460   AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433    GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCGGA-34373873437398-189-200
 OsREG437ACATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCCGCA-34374073437419-209-221
 OsREG422AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632     GGCCCGCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+3437451AK103973, J065101C10, J065168B04, J065184E22, AK073617, AK103973, J033051J11, J100072F09, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J023130H14

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTT+34374713437478AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCGTGGGCCTT+34372693437279AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
 OsREG601TCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCACAA+34372913437301AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCTA+34373143437323AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAAAA+34373363437346AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCTTTT+34373683437379AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
 OsREG433AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCATGT+34373873437398AK073617, AK103973, J023130H14, J033051J11, J065101C10, J065168B04, J065184E22, J080021D11, J080025H10, J080026N19, J080034A12, J080040L02, J080042H19, J080047B05, J080047E09, J080047I01, J080052H19, J080062K13, J080063A22, J080068G18, J080068N19, J080076G08, J080077H13, J080077K06, J080093D15, J080094D21, J080097A20, J080097E21, J080097N17, J100071K18, J100072F09
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437    GCCCATGT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.