version
PlantPromoterDB promoter information of J053054F22

Summary of Gene (J053054F22)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0348700        NCBI 
Gene model J053054F22  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 14037189-14038388)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J053054F22                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J053054F22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+14038960-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCCTATAAATA+1403891614038926-123-113
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGACGT+1403879614038803-243-236
 OsREG447GGTGACGT PPDB MotifACGT  PLACE MotifTGAC 
REGGCAGCCCACCA+1403881114038821-228-218
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCAATCGGCCCACAA+1403883014038850-209-189
 OsREG497CAAGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG658          TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564           CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627            GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597             GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGCCAACGGCC+1403885414038862-185-177
 OsREG518CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494 CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGAGCCGTCC+1403886914038876-170-163
 OsREG468AGCCGTCC PPDB Motif  PLACE Motif 
REGGCAGCCCAGTT+1403888314038893-156-146
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.