version
PlantPromoterDB promoter information of J053073J04

Summary of Gene (J053073J04)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0622400        NCBI 
Gene model J053073J04  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 25637427-25638626)

Genome position     
from initiation codon
005-010-C04         
AK061679            
J013058H01          
J013095D07          
J023054G05          
J023093A17          
J023146P16          
J033089D16          
J033099G12          
J033131N10          
J053074P03          
J053075M06          
J053088K13          
J090039F18          
J090045M03          
TSS from cDNA
TSS information
J053073J04                       5'->3' (+)
Promoter sequence










 
016-034-F01         
J013131D20          
J033115F11          
J033128K19          
J065041K24          
J065089N13          
J065093E17          
J065100J24          
J065120L07          
J065144G19          
J065155K15          
J065191F06          
J065208A14          
J065208D17          
J080303M07          
J090024G04          
J090085H22          
J090097D22          
J100018I17          
J100033J02          
J100049F05          
J100049O22          
J100055H12          
J100067E06          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J053073J04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+25637791-636

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGG+2563750925637516-918-911
 OsREG527GTGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGCGCGGGT+2563753625637543-891-884
 OsREG439GCGCGGGT PPDB Motif  PLACE Motif 
REGAGCCGTCCGATC+2563758025637591-847-836
 OsREG468AGCCGTCC     PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC PPDB Motif  PLACE Motif 
REGTACTGGGCCTC+2563763225637642-795-785
 OsREG604TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCCT+2563764625637656-781-771
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCGGCCCATTT+2563766625637683-761-744
 OsREG610TAATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCCGGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG422          GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.