version
PlantPromoterDB promoter information of J053078A14

Summary of Gene (J053078A14)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0764000        NCBI 
Gene model J053078A14  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33909048-33907849)

Genome position     
from initiation codon
006-025-C07         
006-030-C04         
006-035-E05         
006-044-H04         
006-045-C05         
006-048-H10         
006-050-C01         
006-050-H11         
006-051-G10         
006-051-G11         
006-063-H12         
006-065-G09         
006-067-F11         
006-077-C10         
006-085-F05         
006-097-H11         
006-101-G08         
006-116-H04         
AK059818            
AK099142            
J023055F24          
J065030A17          
J065175O08          
J065200G09          
J075019L08          
J075028M08          
J075111D21          
J090071A01          
J090078D22          
J100019P09          
TSS from cDNA
TSS information
J053078A14                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J053078A14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-33907880-182
TSS clone peakGclone-33907773-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCCTCC-3390776133907771-63-73
Y PatchCCCTTCTC-3390777433907781-76-83
Y PatchCTCCTCCT-3390788933907896-191-198
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG-3390782733907834-129-136
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGACCCGCGCGAG-3390785433907864-156-166
 OsREG439ACCCGCGC    PPDB Motif  PLACE Motif 
 OsREG558   CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCACCGCAC-3390787733907884-179-186
 OsREG500CACCGCAC PPDB Motif  PLACE Motif 
REGGACGGCCCACCCACCAAC-3390792033907937-222-239
 OsREG584GACGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA          PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564  CGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG600    GCCCACCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG520          CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGGCCCCACAC-3390806233908071-364-373
 OsREG631GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC PPDB Motif  PLACE Motif 
REGGGTCCCAC-3390807633908083-378-385
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGTCCCACC-3390814833908155-450-457
 OsREG651GTCCCACC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.