version
PlantPromoterDB promoter information of J065002J16

Summary of Gene (J065002J16)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0610700        NCBI 
Gene model J065002J16  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 24859570-24858371)

Genome position     
from initiation codon
014-008-A03         
AK059205            
AK100281            
J023074H03          
J065032I20          
J065076A07          
J065142O21          
J065203A03          
J075017F24          
J075017G24          
J075053K24          
TSS from cDNA
TSS information
J065002J16                       5'->3' (-)
Promoter sequence










 
AK099736            
J013090G20          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065002J16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24858662-92
TSS clone peakGclone-24858584-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTC-24858542248585492821
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGCCCACGTAGGCCCAAAC-2485871324858733-143-163
 OsREG655TAAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG            PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT           PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG656          TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471           AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625            GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593             GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTTCGTGGGCCGGC-2485873524858747-165-177
 OsREG529TTCGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG601 TCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615     GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG-2485882024858827-250-257
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 
REGGCCCACGGCCACACG-2485883924858853-269-283
 OsREG547GCCCACGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG521  CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG573       GCCACACG PPDB Motif  PLACE Motif 
REGGGCCGTGG-2485890124858908-331-338
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGGCTGGGCTTGG-2485893624858946-366-376
 OsREG464GCTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG428 CTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG496  TGGGCTTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG519   GGGCTTGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.