version
PlantPromoterDB promoter information of J065006P17

Summary of Gene (J065006P17)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0582400        NCBI 
Gene model J065006P17  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24241505-24242704)

Genome position     
from initiation codon
003-104-B09         
AF416867            
AK059423            
AK102676            
J065001F09          
J065005K22          
J065006D10          
J065015G23          
J065020F21          
J065028I05          
J065042N09          
J065043P03          
J065059E15          
J065090I12          
J065130I02          
J065131P05          
J065163I24          
J065168I21          
J065174A12          
J065178K16          
J065182P03          
J065186B07          
J065189M13          
J065208J22          
J065211E11          
J075054E08          
J075067K14          
J075104E20          
J075152M07          
TSS from cDNA
TSS information
J065006P17                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065006P17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+24242428-77
TSS clone peakAclone+24242430-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGTCTATAAATG+2424238824242399-117-106
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGACCCA+2424220024242208-305-297
 OsREG648TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGAGCCCACA+2424221824242225-287-280
 OsREG461AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCAACGGCC+2424226024242267-245-238
 OsREG494CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGCCTGGGCCCACCT+2424228224242294-223-211
 OsREG550CCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCCACACG+2424231024242324-195-181
 OsREG456AGATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598      GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526       CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGGATCCGAC+2424235724242364-148-141
 OsREG588GATCCGAC PPDB MotifCCGAC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.