version
PlantPromoterDB promoter information of J065013K07

Summary of Gene (J065013K07)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0281100        NCBI 
Gene model J065013K07  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 10011354-10010155)

Genome position     
from initiation codon
AK107209            
AK109672            
AY647458            
J065040E15          
J065127F12          
J075155K23          
TSS from cDNA
TSS information
J065013K07                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065013K07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-10010551-197

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCT-1001054210010549-188-195
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGGCCCACTTGTCAGTG-1001059810010616-244-262
 OsREG619GCGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA           PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT         PPDB MotifGCCCA  PLACE Motif 
 OsREG498     CCCACTTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG510           TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGTGTGGGGCC-1001062710010635-273-281
 OsREG611TGTGGGGC  PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC PPDB Motif  PLACE Motif 
REGTTCGTGGGTCCCAC-1001065510010668-301-314
 OsREG529TTCGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG622   GTGGGTCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650      GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGCTCAGCTGGGGCC-1001067210010685-318-331
 OsREG470GCTCAGCT       PPDB Motif  PLACE Motif 
 OsREG580      CTGGGGCC PPDB Motif  PLACE Motif 
REGGTGACGTGTGGCGTG-1001070010010714-346-360
 OsREG505GTGACGTG        PPDB MotifACGT  PLACE MotifTGAC 
 OsREG573    CGTGTGGC    PPDB Motif  PLACE Motif 
 OsREG502       GTGGCGTG PPDB Motif  PLACE Motif 
REGGCCACACG-1001072410010731-370-377
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGGGTGGGACCCACGTGGACACGTGGC-1001078010010804-426-450
 OsREG651GGTGGGAC                  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC                 PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC                PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA               PPDB MotifGGGACCC  PLACE Motif 
 OsREG622    GGACCCAC              PPDB MotifGGGACCC  PLACE Motif 
 OsREG508       CCCACGTG           PPDB MotifACGT  PLACE Motif 
 OsREG451              GGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509               GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434                ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507                 CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.