version
PlantPromoterDB promoter information of J065017G19

Summary of Gene (J065017G19)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0665000        NCBI 
Gene model J065017G19  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34344878-34346077)

Genome position     
from initiation codon
009-149-A12         
AK062995            
J080301G12          
TSS from cDNA
TSS information
J065017G19                       5'->3' (+)
Promoter sequence









 
AY578162            
J100029P11          
J100049H19          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065017G19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34345860-18

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCTGG+3434574134345751-137-127
 OsREG594TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG511  TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAAAA+3434575434345765-124-113
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCAAC+3434577634345786-102-92
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGGCCCATTA+3434580334345810-75-68
 OsREG610GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-34345055AY578162, J100029P11, J100049H19, AY578162

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCTATATATAAACG-3434508334345097AY578162, J100029P11, J100049H19
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.