version
PlantPromoterDB promoter information of J065017J02

Summary of Gene (J065017J02)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0319300        NCBI 
Gene model J065017J02  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 11576224-11577423)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J065017J02                       5'->3' (+)
Promoter sequence

 
009-192-G03         
AK111752            
AK111920            
AK111929            
AY256847            
J023027H09          
J023050M21          
J023123C08          
J023127P06          
J075018L06          
J075028C07          
J075033K04          
J075058F17          
J075090L14          
J075123B18          
J075159K13          
J075165O13          
J075173K03          
J075181D10          
J090006M11          
J090048C14          
J090067J03          
J090092M15          
J100068P10          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065017J02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+11573339-135
TSS clone peakAclone+11573343-131

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGGTATAAAGG+1157330411573315-170-159
Y PatchTCTTCCCC+1157338111573388-93-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGCGTCGCG+1157304511573055-429-419
 OsREG583GTCGCGTC    PPDB Motif  PLACE Motif 
 OsREG559  CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556   GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGACGCGTCC+1157309711573104-377-370
 OsREG442ACGCGTCC PPDB Motif  PLACE Motif 
REGCGCGGGGG+1157324011573247-234-227
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 
REGGAGGCGTGGA+1157326211573271-212-203
 OsREG503GAGGCGTG   PPDB Motif  PLACE Motif 
 OsREG636  GGCGTGGA PPDB Motif  PLACE Motif 
REGAACGGGCCGGT+1157327811573288-196-186
 OsREG424AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG440   GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.