version
PlantPromoterDB promoter information of J065019D10

Summary of Gene (J065019D10)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0461100        NCBI 
Gene model J065019D10  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 23424930-23426129)

Genome position     
from initiation codon
009-136-H10         
009-147-H12         
AK068022            
J013130N24          
J065168O21          
J065172N22          
J065189A17          
J075051G06          
J075148G11          
TSS from cDNA
TSS information
J065019D10                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065019D10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+23425894-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCTT+2342588723425899-43-31
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCTGGGCCGGGCCGTTT+2342576023425777-170-153
 OsREG486ATCTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC      PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC     PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG    PPDB Motif  PLACE Motif 
 OsREG446        CGGGCCGT   PPDB MotifACGGGC  PLACE Motif 
 OsREG423         GGGCCGTT  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG420          GGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGGCTGGGCCATATTGGGCTTT+2342578123425800-149-130
 OsREG620GCTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG487  TGGGCCAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG596         TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460          ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426           TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421            TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACA+2342581423425821-116-109
 OsREG461AGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.