version
PlantPromoterDB promoter information of J065025M24

Summary of Gene (J065025M24)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0720700        NCBI 
Gene model J065025M24  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 31797442-31798641)

Genome position     
from initiation codon
J033124M22          
J065006G21          
J065041J02          
J065044B14          
J065061J06          
J065116L21          
J075030F18          
J075034K17          
J075063I02          
J075110D21          
J075188L15          
J075197B17          
TSS from cDNA
TSS information
J065025M24                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065025M24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+31798372-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTC+3179837731798384-65-58
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCGAG+3179814831798155-294-287
 OsREG575GGGCCGAG PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCAGGCCC+3179816831798182-274-260
 OsREG449ACGTGGGC        PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG     PPDB MotifGCCCA  PLACE Motif 
 OsREG524       CCAGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCCCACGCGTCC+3179821031798221-232-221
 OsREG602GCCCACGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG530 CCCACGCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG443  CCACGCGT   PPDB Motif  PLACE Motif 
 OsREG442    ACGCGTCC PPDB Motif  PLACE Motif 
REGTCCGGGCCCACGC+3179826931798281-173-161
 OsREG633TCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602     GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGACGTGTCC+3179831831798325-124-117
 OsREG451ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.