version
PlantPromoterDB promoter information of J065033D14

Summary of Gene (J065033D14)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0533800        NCBI 
Gene model J065033D14  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 20508226-20507027)

Genome position     
from initiation codon
009-149-F12         
013-058-H02         
014-017-G07         
014-028-F04         
014-050-G04         
014-095-F04         
014-099-C08         
016-046-F05         
AK121139            
J013104A14          
J023077F13          
J023145I11          
J065079I15          
J065104E21          
J065128E06          
J065174F07          
J065195B12          
J065207B12          
J080304M24          
J090040A13          
J090054B18          
J100037A06          
J100042F24          
J100043N23          
J100044H14          
J100056K24          
J100063O22          
J100071G05          
J100078G15          
TSS from cDNA
TSS information
J065033D14                       5'->3' (-)
Promoter sequence





 
006-022-D07         
012-014-E01         
AB062681            
AK061722            
AK106147            
AK121892            
J013045C19          
J013170C10          
J033058C15          
J033105C15          
J033120B19          
J065029J08          
J065098B15          
J065098J23          
J100036F05          
J100077E11          
J100087A08          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065033D14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20507340-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACA-2050739720507404-171-178
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGATCCGACGG-2050740620507414-180-188
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGTAGGCCCAGA-2050754420507553-318-327
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAAAC-2050756420507574-338-348
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGGCCGGGCCGGG-2050758120507592-355-366
 OsREG614GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616 GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544  CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG538    GGGCCGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+20507823AK121892, AK121892, AK061722, AK106147, AB062681

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCTGGGCCTA+2050754420507553AB062681, AK061722, AK106147, AK121892
 OsREG629TCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCTC+2050756420507574AB062681, AK061722, AK106147, AK121892
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCGGCC+2050758120507592AB062681, AK061722, AK106147, AK121892
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG   PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC  PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC PPDB Motif  PLACE Motif 
REGCCACCAAC+2050764420507651AB062681, AK061722, AK106147, AK121892
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCGGATCGGACGG+2050765920507670AB062681, AK061722, AK106147, AK121892
 OsREG541CGGATCGG     PPDB Motif  PLACE Motif 
 OsREG589  GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484   ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545    TCGGACGG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.