version
PlantPromoterDB promoter information of J065035I22

Summary of Gene (J065035I22)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0245100        NCBI 
Gene model J065035I22  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 8106896-8108095)

Genome position     
from initiation codon
AK100710            
J023048C16          
J023110L14          
J023115F20          
J053023B18          
J053031L17          
J065043D21          
J065072L16          
J065085H06          
J065214I23          
TSS from cDNA
TSS information
J065035I22                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065035I22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+8107798-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCCCCTCCC+81077518107764-145-132
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACGGGACTCGACGCCCACCACACGGCCCAGC+81075888107621-308-275
 OsREG531CCCACGGG                           PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG586       GACTCGAC                    PPDB Motif  PLACE Motif 
 OsREG599               GCCCACCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG527                CCCACCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG504                       CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445                        ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565                         CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620                          GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCCCACTTG+81076268107640-270-256
 OsREG525CCATGGGC        PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498       CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGCCCCACGTG+81076568107664-240-232
 OsREG450CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508 CCCACGTG PPDB MotifACGT  PLACE Motif 
REGCAAGTGGGGCCGGG+81076738107686-223-210
 OsREG498CAAGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG538      GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGGGGCCCCACCTGTCAGT+81077028107718-194-178
 OsREG641GGGCCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC         PPDB Motif  PLACE Motif 
 OsREG612  GCCCCACC        PPDB Motif  PLACE Motif 
 OsREG514    CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551        CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453         CTGTCAGT PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.