version
PlantPromoterDB promoter information of J065038G19

Summary of Gene (J065038G19)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0432600        NCBI 
Gene model J065038G19  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 21491730-21490531)

Genome position     
from initiation codon
AK058925            
AK103967            
AK121724            
J033058C20          
J033081P13          
J033128L11          
J065077A06          
J065129A21          
J065131P11          
J065166I03          
J065181L05          
J065181N03          
J100018I15          
J100019H22          
J100037O10          
TSS from cDNA
TSS information
J065038G19                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065038G19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-21490833-103
TSS clone peakAclone-21490821-91
TSS cloneCclone-21490791-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAC-2149089221490900-162-170
 OsREG582GAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC PPDB MotifGCCCA  PLACE Motif 
REGCTGGGGCCCAAG-2149090521490916-175-186
 OsREG580CTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639   GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581    GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCATGGAGGCCCACACGGCCCATGT-2149092421490954-194-224
 OsREG646TCAGGCCC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA                       PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT                      PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG           GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525    GCCCATGG                    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG587           GAGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG472            AGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG627             GGCCCACA           PPDB MotifGCCCA  PLACE Motif 
 OsREG598              GCCCACAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG526               CCCACACG         PPDB MotifGCCCA  PLACE Motif 
 OsREG504                   CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445                    ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490                     CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG437                       GCCCATGT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.