version
PlantPromoterDB promoter information of J065038L22

Summary of Gene (J065038L22)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0633800        NCBI 
Gene model J065038L22  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 24971986-24973185)

Genome position     
from initiation codon
AK073044            
J065185C13          
TSS from cDNA
TSS information
J065038L22                       5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065038L22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+24972856-130

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATAAAAC+2497281824972828-168-158
Y PatchCTCTCCCCC+2497280724972815-179-171
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCTTGGGCCGTGGTGGGTGGGCCCCACAC+2497261924972649-367-337
 OsREG519GGGCTTGG                        PPDB MotifGCCCA  PLACE Motif 
 OsREG581   CTTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG563    TTGGGCCG                    PPDB MotifGCCCA  PLACE Motif 
 OsREG445     TGGGCCGT                   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504      GGGCCGTG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG521       GGCCGTGG                 PPDB Motif  PLACE Motif 
 OsREG527           GTGGTGGG             PPDB MotifGCCCA  PLACE Motif 
 OsREG600                GGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628                 GGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640                  GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647                   TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641                    GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631                     GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611                      GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535                       CCCCACAC PPDB Motif  PLACE Motif 
REGCATGGGCTGC+2497266224972671-324-315
 OsREG467CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491 ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591  TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGGATCCGACGGCCC+2497267724972689-309-297
 OsREG588GATCCGAC      PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG    PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584     GACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGC+2497270124972708-285-278
 OsREG616GGCCCGGC PPDB Motif  PLACE Motif 
REGCGCGTCGC+2497272124972728-265-258
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCCCGGGCCCCACCTGTC+2497273424972750-252-236
 OsREG539CCCGGGCC          PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC        PPDB MotifACGGGC  PLACE Motif 
 OsREG641   GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC     PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC PPDB Motif  PLACE Motif 
REGGCCCCACCCG+2497275424972763-232-223
 OsREG612GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528  CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGCCCACCC+2497277124972778-215-208
 OsREG600GCCCACCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.