version
PlantPromoterDB promoter information of J065039I18

Summary of Gene (J065039I18)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0744000        NCBI 
Gene model J065039I18  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 32084366-32085565)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J065039I18                       5'->3' (+)
Promoter sequence

 
015-073-D10         
AK064134            
AK111254            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065039I18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+32089094-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTCCGAT+3208880432088811-362-355
 OsREG484CGTCCGAT PPDB Motif  PLACE Motif 
REGCGGACGGA+3208886032088867-306-299
 OsREG561CGGACGGA PPDB Motif  PLACE Motif 
REGAACGGGCC+3208887532088882-291-284
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAGCCCACGGG+3208888632088895-280-271
 OsREG463AGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG547 GCCCACGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG531  CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGTCCGGCCCAAAC+3208891032088921-256-245
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCCAAGCCCAAAA+3208896832088979-198-187
 OsREG519CCAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457   AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-32084564AK064134, AK064134, AK111254
TSS clone peakAclone-32084558AK064134, AK064134, AK111254

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAATC-3208459332084600AK064134, AK111254
Y PatchTCCTTCCTC-3208453432084542AK064134, AK111254
Y PatchCCTCCTCTT-3208460632084614AK064134, AK111254
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGACCCAC-3208467932084686AK064134, AK111254
 OsREG622GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGGATGGGCCTTG-3208469732084708AK064134, AK111254
 OsREG608GGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG PPDB MotifGCCCA  PLACE Motif 
REGACCCGCGC-3208475732084764AK064134, AK111254
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.