version
PlantPromoterDB promoter information of J065040D24

Summary of Gene (J065040D24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0160100        NCBI 
Gene model J065040D24  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 3185799-3186998)

Genome position     
from initiation codon
AF305911            
AK111595            
AY167575            
J013070N08          
J013091G05          
J013095M23          
J023143A04          
J065157O13          
J065176H08          
J075062B17          
J090060P05          
J100024K08          
J100044F21          
TSS from cDNA
TSS information
J065040D24                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065040D24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCACGGCCCAGT+31869553186965AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT PPDB MotifGCCCA  PLACE Motif 
REGCATCCCCC+31869683186975AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
 OsREG516CATCCCCC PPDB Motif  PLACE Motif 
REGCCCACTCT+31869983187005AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.