PlantPromoterDB promoter information of J065040D24

Summary of Gene (J065040D24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0160100        NCBI 
Gene model J065040D24  
Description NONE  


Focused view (chromosome 3: 3186349-3187548)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J065040D24                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J065040D24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+3187198AK064836, J033060H13, J033118E14, J043039J02, J043039N08, J023086E11, J023114B19, AK071081, J043030N04, J023013O19, J023044M05, J013041A17, J013088K24, AK064836, J013000F21, J013024G05, J013047F10, J023069G09, J023091I09, J033075P14, J033092E18, J033123C07, J013063J23, J023139I06, J013045F04, J013059O17, J013098G04, J013102E18, J013146H15, J023101D06, J023109B03, J023134F22, J033112I05, J090023J24, J090033H01, AK104859, J043003C01, J033101G23, J013119M18, J013149A14, J013046F04, J013059J07, J013123I19, J023048O03, J023049L17, J033084O05, J013060A20, J023091M19, J033118P04, J023003A05, J033087G04, AK100712, J013066D19, J013100I15, J023115H16, J090022G17, J090038A03, J090049E10, J090063E24, J100021G23, J100028P06, J100060L21, J100077D16, J090041O22, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J023060D22, J023060F20, J023113B14, J043024B21, J090020H22, J013045D10, J013035E12, J013102O09, J013069O08, J023150C02, J033058O11, J013051E10, J033033A14, J100088I09, J090014O14, J090080N12
TSS clone peakCclone+3187235AK064836, J033060H13, J033118E14, J043039J02, J043039N08, J023086E11, J023114B19, AK071081, J043030N04, J023013O19, J023044M05, J013041A17, J013088K24, AK064836, J013000F21, J013024G05, J013047F10, J023069G09, J023091I09, J033075P14, J033092E18, J033123C07, J013063J23, J023139I06, J013045F04, J013059O17, J013098G04, J013102E18, J013146H15, J023101D06, J023109B03, J023134F22, J033112I05, J090023J24, J090033H01, AK104859, J043003C01, J033101G23, J013119M18, J013149A14, J013046F04, J013059J07, J013123I19, J023048O03, J023049L17, J033084O05, J013060A20, J023091M19, J033118P04, J023003A05, J033087G04, AK100712, J013066D19, J013100I15, J023115H16, J090022G17, J090038A03, J090049E10, J090063E24, J100021G23, J100028P06, J100060L21, J100077D16, J090041O22, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J023060D22, J023060F20, J023113B14, J043024B21, J090020H22, J013045D10, J013035E12, J013102O09, J013069O08, J023150C02, J033058O11, J013051E10, J033033A14, J100088I09, J090014O14, J090080N12

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+31871563187163AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09

REG information

TypeSequenceAnnotationGenome positionGene model
REGCACGGCCCAGT+31869553186965AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
REGCATCCCCC+31869683186975AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
REGCCCACTCT+31869983187005AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
REGCACACACC+31870283187035AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
REGCCCACCACGCGTCC+31870433187056AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
 OsREG443    CCACGCGT   PPDB Motif  PLACE Motif 
 OsREG442      ACGCGTCC PPDB Motif  PLACE Motif 
REGGCCCAGATCCAACGGCT+31870863187102AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
 OsREG486GCCCAGAT          PPDB MotifGCCCA  PLACE Motif 
REGCATCCCCCA+31871103187118AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
REGGTGACGTGGACCGGACGCGTCC+31871323187153AK064836, AK071081, AK100712, AK104859, J013000F21, J013024G05, J013035E12, J013041A17, J013045D10, J013045F04, J013046F04, J013047F10, J013051E10, J013059J07, J013059O17, J013060A20, J013063J23, J013066D19, J013069O08, J013088K24, J013098G04, J013100I15, J013102E18, J013102O09, J013119M18, J013123I19, J013146H15, J013149A14, J023003A05, J023013O19, J023044M05, J023048O03, J023049L17, J023060D22, J023060F20, J023069G09, J023086E11, J023091I09, J023091M19, J023101D06, J023109B03, J023113B14, J023114B19, J023115H16, J023134F22, J023139I06, J023150C02, J033033A14, J033058O11, J033060H13, J033075P14, J033084O05, J033087G04, J033092E18, J033101G23, J033112I05, J033118E14, J033118P04, J033123C07, J043003C01, J043024B21, J043030N04, J043039J02, J043039N08, J075006N21, J075008A16, J075018J16, J075023G04, J075134F18, J075181B05, J090014O14, J090020H22, J090022G17, J090023J24, J090033H01, J090038A03, J090041O22, J090049E10, J090063E24, J090080N12, J100021G23, J100028P06, J100060L21, J100077D16, J100088I09
 OsREG505GTGACGTG               PPDB MotifACGT  PLACE MotifTGAC 
 OsREG570    CGTGGACC           PPDB Motif  PLACE Motif 
 OsREG442            GGACGCGTCC PPDB Motif  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.