version
PlantPromoterDB promoter information of J065041P10

Summary of Gene (J065041P10)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0448800        NCBI 
Gene model J065041P10  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 16065709-16066908)

Genome position     
from initiation codon
003-112-B05         
003-118-A02         
006-029-E09         
006-056-F11         
006-081-F01         
006-084-H12         
006-094-A12         
006-095-C01         
006-098-F09         
009-151-B09         
009-169-C08         
009-172-F09         
009-200-H03         
011-008-B03         
011-035-C10         
011-041-G11         
011-059-H01         
011-071-D12         
013-010-E11         
013-015-B06         
013-028-A11         
013-037-A04         
013-057-B07         
014-041-D03         
014-073-G04         
014-093-D10         
016-030-F03         
016-034-B08         
016-064-D05         
AF062393            
AK072519            
AK103938            
AK103970            
AK119656            
J023026N01          
J023055M16          
J023063J21          
J023128K12          
J065134L07          
J075198L17          
J090032B21          
J090032D13          
J090057J22          
J090062J02          
J100028J09          
J100053C06          
J100056I11          
J100067E10          
TSS from cDNA
TSS information
J065041P10                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065041P10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+16066600-109
TSS clone peakAclone+16066602-107

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC+1606655616066563-153-146
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCATCCA+1606634816066359-361-350
 OsREG430AAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534    CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCCCACACG+1606651216066519-197-190
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.