version
PlantPromoterDB promoter information of J065041P19

Summary of Gene (J065041P19)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0206600        NCBI 
Gene model J065041P19  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 5806025-5807224)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J065041P19                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065041P19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+5806970-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCCTC+58069805806987-45-38
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTC+58067145806721-311-304
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGGGACC+58067475806754-278-271
 OsREG650GTGGGACC PPDB MotifGGGACCC  PLACE Motif 
REGCACGTGTC+58068715806878-154-147
 OsREG509CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTAATGGGCCTGAAGCCCACATGGCCCATA+58068965806924-129-101
 OsREG610TAATGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG                   PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG582          GAAGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG427           AAGCCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG461            AGCCCACA          PPDB MotifGCCCA  PLACE Motif 
 OsREG487                   ATGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488                    TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630                     GGCCCATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.