version
PlantPromoterDB promoter information of J065042K22

Summary of Gene (J065042K22)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0680400        NCBI 
Gene model J065042K22  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 29763903-29765102)

Genome position     
from initiation codon
AK067914            
J065039K13          
J080016E23          
J080064E22          
TSS from cDNA
TSS information
J065042K22                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065042K22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29764897-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCGTG+2976467729764684-226-219
 OsREG503GAGGCGTG PPDB Motif  PLACE Motif 
REGTCGGCCCAGA+2976476129764770-142-133
 OsREG658TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCC+2976477329764780-130-123
 OsREG644TCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCACGCG+2976478729764798-116-105
 OsREG430AAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530    CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCACCAAGCCC+2976480329764818-100-85
 OsREG591GCAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC       PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG519        CCAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCAAAA+2976484429764855-59-48
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.