version
PlantPromoterDB promoter information of J065044F12

Summary of Gene (J065044F12)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0112800        NCBI 
Gene model J065044F12  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 701223-702422)

Genome position     
from initiation codon
AK058206            
J023052P13          
J033064G11          
J065047I05          
J065059P17          
J065180P17          
J075131M22          
TSS from cDNA
TSS information
J065044F12                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065044F12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+702009-214

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC+702038702045-185-178
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCCTGATCTGGGCCACTTTGGGCCTTG+701889701921-334-302
 OsREG607TGATGGGC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC                         PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                        PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG                       PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA                      PPDB MotifGCCCA  PLACE Motif 
 OsREG486           ATCTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG629            TCTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG578             CTGGGCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG653              TGGGCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625                      TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG471                       TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG430                        TGGGCCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG497                         GGGCCTTG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCATTT+701952701963-271-260
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.