version
PlantPromoterDB promoter information of J065051O15

Summary of Gene (J065051O15)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0116800        NCBI 
Gene model J065051O15  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 923499-924698)

Genome position     
from initiation codon
012-097-D10         
016-024-H10         
AK066955            
AK104839            
J013033G16          
J013091C10          
J023106K11          
J065129G22          
J075001K02          
J075011O03          
J075024K04          
J075026E07          
J075037O14          
J075071D17          
J075084M05          
J075114B06          
J075128C23          
J075153A13          
J075158A15          
J075165P09          
J075167M21          
J075170F11          
J075186F12          
J075186L13          
J075189A01          
J075192D19          
TSS from cDNA
TSS information
J065051O15                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065051O15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+924379-120

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACACGTGGC+924095924104-404-395
 OsREG509GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507  CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCACGTGGG+924125924134-374-365
 OsREG507GCCACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508  CACGTGGG PPDB MotifACGT  PLACE Motif 
REGGCCCCACC+924184924191-315-308
 OsREG612GCCCCACC PPDB Motif  PLACE Motif 
REGCCCACGCGACGCGAC+924198924212-301-287
 OsREG530CCCACGCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG556    CGCGACGC    PPDB Motif  PLACE MotifCGACG 
 OsREG559     GCGACGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583       GACGCGAC PPDB Motif  PLACE Motif 
REGGCGGTGCG+924248924255-251-244
 OsREG554GCGGTGCG PPDB Motif  PLACE Motif 
REGGAAGCCCACCAC+924269924280-230-219
 OsREG582GAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+924499AK068678, J013158H22

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCCTCCTCTC+924458924472AK068678, J013158H22
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCCGTGG+924352924359AK068678, J013158H22
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGGGTTGGGC+924382924389AK068678, J013158H22
 OsREG595GGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGCGGTGCG+924433924440AK068678, J013158H22
 OsREG554GCGGTGCG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.