version
PlantPromoterDB promoter information of J065056D01

Summary of Gene (J065056D01)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0178400        NCBI 
Gene model J065056D01  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 4331352-4332551)

Genome position     
from initiation codon
009-151-B08         
AK063815            
AK121516            
J033026A17          
J065011K14          
J065061L22          
J065076M01          
J075092E14          
TSS from cDNA
TSS information
J065056D01                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065056D01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4332269-83
TSS clone peakGclone+4332271-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACTGGGCCGC+43320734332083-279-269
 OsREG425AACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCTTA+43321134332123-239-229
 OsREG456AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCACA+43321284332137-224-215
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCCACT+43321564332168-196-184
 OsREG425AACTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCATGGGCCGGA+43321724332188-180-164
 OsREG656TAGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG525   GCCCATGGGC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517  GGCCCATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490       ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542        TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644         GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCACGAGGCCCATAA+43321974332216-155-136
 OsREG660TTGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG           PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG587         GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474          AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630           GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605            GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.