version
PlantPromoterDB promoter information of J065066F23

Summary of Gene (J065066F23)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0799000        NCBI 
Gene model J065066F23  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34154303-34155502)

Genome position     
from initiation codon
                    
013-010-A07         
013-081-H02         
AK067840            
AK099211            
J065138O20          
J065163G22          
J065211J01          
J090095G02          
J100058H04          
Os03g0798900        
TSS from cDNA
TSS information
J065066F23                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065066F23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34155192-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCACTATATAAC+3415515334155164-150-139
Y PatchCTCTCTCTCTCTCT+3415522734155240-76-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGATGGG+3415494434154951-359-352
 OsREG534TGGATGGG PPDB MotifGCCCA  PLACE Motif 
REGGGCCGGGC+3415496134154968-342-335
 OsREG614GGCCGGGC PPDB Motif  PLACE Motif 
REGGACCGTTGGATGGG+3415502534155038-278-265
 OsREG495GACCGTTG       PPDB MotifCCAACGG  PLACE Motif 
 OsREG548  CCGTTGGA     PPDB MotifCCAACGG  PLACE Motif 
 OsREG481   CGTTGGAT    PPDB MotifCCAACGG  PLACE Motif 
 OsREG534      TGGATGGG PPDB MotifGCCCA  PLACE Motif 
REGCGGATCGG+3415504134155048-262-255
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGTGTGGGGCGCGTGGG+3415506434155078-239-225
 OsREG611TGTGGGGC        PPDB Motif  PLACE Motif 
 OsREG530       CGCGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGGCCGTTTCGGCC+3415509634155108-207-195
 OsREG420GGCCGTTT      PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG634     TTTCGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.