version
PlantPromoterDB promoter information of J065069A13

Summary of Gene (J065069A13)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0824400        NCBI 
Gene model J065069A13  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 36311480-36310281)

Genome position     
from initiation codon
AK121390            
J023128P21          
J053097O16          
J065012I02          
J065049C06          
J065051H02          
J065082E04          
J065102N09          
J065157O10          
J065188N23          
J065190J11          
J065202M09          
TSS from cDNA
TSS information
J065069A13                       5'->3' (-)
Promoter sequence








 
AK111296            
J065048M11          
J065081F01          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065069A13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-36310548-68

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCAATT-3631058936310599-109-119
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCTTG-3631061236310623-132-143
 OsREG593GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCTTTGATGGGCTTT-3631063536310656-155-176
 OsREG425AACTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG607           TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466            GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429             ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421              TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGCACGTCAC-3631072336310730-243-250
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGCCACGTGTCC-3631073436310744-254-264
 OsREG507GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451   ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTCGGCCCG-3631074636310753-266-273
 OsREG568TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGCGCCACGTGTCC-3631077436310785-294-305
 OsREG448CGCCACGT     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451    ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+36310990AK111296, AK111296, J065048M11, J065081F01

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTGACGTG+3631072336310730AK111296, J065048M11, J065081F01
 OsREG505GTGACGTG PPDB MotifACGT  PLACE MotifTGAC 
REGGGACACGTGGC+3631073436310744AK111296, J065048M11, J065081F01
 OsREG451GGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGGGCCGA+3631074636310753AK111296, J065048M11, J065081F01
 OsREG568CGGGCCGA PPDB MotifACGGGC  PLACE Motif 
REGGGACACGTGGCG+3631077436310785AK111296, J065048M11, J065081F01
 OsREG451GGACACGT     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG   PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448    ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGACCCGCGC+3631089036310897AK111296, J065048M11, J065081F01
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.