version
PlantPromoterDB promoter information of J065070A01

Summary of Gene (J065070A01)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0689200        NCBI 
Gene model J065070A01  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 29153362-29154561)

Genome position     
from initiation codon
011-024-D04         
AK065336            
AK071254            
AK072660            
J013000O22          
J023087G23          
J023134O11          
J033095E21          
J033113F12          
J033124F02          
J065129C05          
J065165M19          
J090015K07          
J090016L11          
J090066D21          
J090075M20          
TSS from cDNA
TSS information
J065070A01                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065070A01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+29153430-932
TSS clone peakAclone+29153442-920
TSS clone peakGclone+29154251-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCCCCTC+2915343029153441-932-921
Y PatchTCTTCCCC+2915423729154244-125-118
Y PatchTTCTCCTCCT+2915427129154280-91-82
Y PatchCTCCCTCTCTCTCC+2915428629154299-76-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGCCCATAA+2915330729153317-1055-1045
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCAGA+2915333329153342-1029-1020
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAAA+2915336929153378-993-984
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCGAGCCG+2915404929154061-313-301
 OsREG540CCGAGCCGAGCCG PPDB Motif  PLACE Motif 
REGTGTGGGCTTGG+2915408029154090-282-272
 OsREG461TGTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG427 GTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG496  TGGGCTTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG519   GGGCTTGG PPDB MotifGCCCA  PLACE Motif 
REGGCCCCACC+2915420029154207-162-155
 OsREG612GCCCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.