version
PlantPromoterDB promoter information of J065072N14

Summary of Gene (J065072N14)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0661200        NCBI 
Gene model J065072N14  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34138463-34137264)

Genome position     
from initiation codon
AK102842            
J013105N03          
J033075E19          
J033095L21          
J033109O19          
J065002J12          
J065026E22          
J065061F05          
J065068D22          
J065085F02          
J075055G19          
J075105B14          
J075118M17          
J075193H02          
J100040O05          
J100064I04          
TSS from cDNA
TSS information
J065072N14                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065072N14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-34137904-441

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCTTCCTCCTCCTC-3413785734137875-394-412
Y PatchTCCTTCCT-3413792534137932-462-469
Y PatchTCTCCTCCT-3413794534137953-482-490
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCTC-3413795034137957-487-494
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 
REGCACGTGGC-3413797234137979-509-516
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCACGTGGGCCCGCACCGC-3413798334138002-520-539
 OsREG507GCCACGTG             PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508  CACGTGGG           PPDB MotifACGT  PLACE Motif 
 OsREG449   ACGTGGGC          PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571    CGTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG566      TGGGCCCG       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619       GGGCCCGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG632        GGCCCGCA     PPDB Motif  PLACE Motif 
 OsREG554            CGCACCGC PPDB Motif  PLACE Motif 
REGGCCCATCG-3413808134138088-618-625
 OsREG553GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCG-3413811434138121-651-658
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCGCGCGAG-3413819334138201-730-738
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558 CGCGCGAG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.