version
PlantPromoterDB promoter information of J065074C19

Summary of Gene (J065074C19)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0314300        NCBI 
Gene model J065074C19  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 11959323-11958124)

Genome position     
from initiation codon
AK073419            
AK104939            
J033044B03          
J033060E12          
J043037E21          
J065019O18          
J065025P22          
J065042P06          
J065074E13          
J065094E05          
J065108N08          
J065134L13          
J065152N24          
J065162N24          
J065170P16          
J065177M20          
J065187N01          
J075012N12          
J075046C17          
J075055N06          
J075141H03          
J075150M11          
J090005B16          
J090027M05          
J090053P20          
J090079L11          
J090087N19          
J090088J10          
J100039F16          
TSS from cDNA
TSS information
J065074C19                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065074C19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-11958444-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCT-1195839611958404-73-81
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGCCCATCT-1195848411958494-161-171
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCCACCAC-1195850411958518-181-195
 OsREG592TTTTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599      GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527       CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-1195854711958554-224-231
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGCGTCCGAT-1195855811958565-235-242
 OsREG484CGTCCGAT PPDB Motif  PLACE Motif 
REGGCCCACCT-1195866611958673-343-350
 OsREG476GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTC-1195868211958689-359-366
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGACCCGC-1195869511958702-372-379
 OsREG552CGACCCGC PPDB Motif  PLACE Motif 
REGGCGGTGCG-1195870711958714-384-391
 OsREG554GCGGTGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.