version
PlantPromoterDB promoter information of J065074O11

Summary of Gene (J065074O11)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0162200        NCBI 
Gene model J065074O11  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 3019822-3021021)

Genome position     
from initiation codon
009-059-H04         
AK060396            
J065105K09          
J075024G12          
J075040K04          
J075066D13          
J075108A11          
J100031D04          
J100060O05          
J100075M22          
TSS from cDNA
TSS information
J065074O11                       5'->3' (+)
Promoter sequence









 
                    
Os11g0162100        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065074O11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+3020710-112

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTC+30207513020758-71-64
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGCCCAGCC+30205563020566-266-256
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCAAAAGCCCAAAA+30205833020603-239-219
 OsREG609TCATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC             PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG419         AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421          AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426           AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457            AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592             GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAATTCAGCCCATCT+30206113020629-211-193
 OsREG460AGCCCAAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG433 GCCCAATT           PPDB MotifGCCCA  PLACE Motif 
 OsREG657        TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491         CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466          AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456           GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.